DNA: code introduction

DNA (Deoxyribonucleic Acid) is known as the code of life, a (fairly) fault-tolerant digital code. It contains the building blocks of plant and human life.

All 20 human amino acids can be created with these building blocks and are used to make complex molecules called proteins which make enzymes.

Together, proteins and enzymes control almost everything that happens in life from conception through life until death.

The four possible base pairs are:

adenine (A)
guanine (G)
thymine (T)
cytosine (C)

Since there are four bases, each can represent one of four vales, or 2 bits if coded information. DNA bases

Each base pair can be connected to the backbone. DNA one chain

Whenever two backbones are paired, each base pair can only fit with one of the other base pairs. DNA two chains

Three base pairs specify one amino acid. Since each base pair represents 2 bits of information, a group of three pairs, called a codon, can represent 2 or one of 64 encodings. DNA code

DNA is a fault-tolerant, digital code.

There is a lot of research into inferring higher level grammars for the low level DNA codes.

The four possible base pairs are called

adenine (A),
guanine (G),
thymine (T), and
cytosine (C).

The four bases of DNA are arranged along a sugar-phosphate backbone in a particular order called the DNA sequence.

This sequence of base pairs encodes all genetic instructions for an organism.

A gene is a segment of a DNA molecule located in a specific chromosome. A gene contains the information necessary for protein synthesis.

Each of the four nucleotides pairs with another nucleotide.

The base adenine (A) pairs with the base thymine (T).
The base cytosine (C) pairs with the base guanine (G).

The DNA is coiled in a double-helix (i.e., twisted ladder) shape. If the DNA from one human cell were fully uncoiled, it would be 6 feet long.

The digital code of base pairs divided into triplets called codons.

There are 4 * 4 * 4 = 64 possible codons. Some are start codes, some are stop codes, some allow for fault tolerance or overlapping codes, etc.

All 20 human amino acids can be created with these codons. Some codons are start/stop triplets that are used during copying.

The 20 human amino acids are used to make complex molecules called proteins.

Proteins make enzymes.

Together, proteins and enzymes control almost everything that happens in life from conception through life until death.

The Genome project mapped the entire sequence of human DNA.

Here are the first 25 lines of Chromosome 1.

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCACCACCATCA CCAAGACCATCATCATCACCATCACCACCAACATCACCACCATCACCAACACCACCATCA CCACCACCACCACCATCATCACCACCACCACCATCATCATCACCACCACCGCCATCATCA TCGCCACCACCATGACCACCACCATCACAACCATCACCACCATCACAACCACCATCATCA CTATCGCTATCACCACCATCACCATTACCACCACCATTACTACAACCATGACCATCACCA CCATCACCACCACCATCACAACGATCACCATCACAGCCACCATCATCACCACCACCACCA CCACCATCACCATCAAACCATCGGCATTATTATTTTTTTAGAATTTTGTTGGGATTCAGT ATCTGCCAAGATACCCATTCTTAAAACATGAAAAAGCAGCTGACCCTCCTGTGGCCCCCT TTTTGGGCAGTCATTGCAGGACCTCATCCCCAAGCAGCAGCTCTGGTGGCATACAGGCAA CCCACCACCAAGGTAGAGGGTAATTGAGCAGAAAAGCCACTTCCTCCAGCAGTTCCCTGT CTGAGCTGCTGTCCTTGGACTTGAAGAAGCTTCTGGAACATGCTGGGGAGGAAGGAAGAC ATTTCACTTATTGAGTGGCCTGATGCAGAACAGAGACCCAGCTGGTTCACTCTAGTTCGG

http://www.sacred-texts.com/dna/hgp011k.htm (as of 1997)

One copy of a human DNA consists of a sequence of 3.2 billion base pairs, or nucleotides.

A typical human body has 50 to 100 trillion cells.

Every person has a unique DNA that contains the genetic code that makes you what you are.

How much DNA information can be printed on one page?

A page has 50 lines of 60 characters/nucleotides (i.e., "A", "T", "G", or "C").
3,000 characters/nucleotides per page .
A ream (500 pages) is about 1-1/2 inches tall.
4,000 pages per foot.

Print out all of the DNA of one human.

100,000,000,000,000 copies (100 trillion)

Your DNA consists of over 3,000,000,000 (3 billion) nucleotides (i.e., over 6,000,000,000 (6 billion) bits of information encoded as "A", "C", "G", or "T",) encoded in (almost) all of about 100,000,000,000,000 (100 trillion) cells in your body.

Who owns your DNA?

A chain is a linked structure with one link connected to the next link.

Remove a link, the chain falls apart.
Security is as strong as the weakest link.

Mathematical theories have similar characteristics.

DNA is a linked chain of nucleotides.

Proteins are a linked chain of amino acids.

3 Billion nucleotides.

Enlarge the cell nucleus to the size of a basketball.

The DNA is like 120 miles of fishing line inside the basketball.

You have to be able to unwind it to find the code segment you need, transcribe it, and wind it back up, without tangling.

BLAST (Basic Local Alignment Search Tool), as defined by Wikipedia:

In bioinformatics, BLAST (basic local alignment search tool)is an algorithm for comparing primary biological sequence information, such as the amino-acid sequences of proteins or the nucleotides of DNA and/or RNA sequences.

Miller has been developing algorithms and software for analyzing DNA sequences and related types of data from molecular genetics. He is one of the authors of BLAST.[6][7] He also develops methods for aligning long DNA sequences and extracting functional information from them. Webb Miller has made important contributions to the analysis of many vertebrate genomes. He is regarded as one of the pioneers in the field of computational biology.